NEWSLETTER

of the

AMERICAN SCIENTIFIC AFFILIATION - CANADIAN SCIENTIFIC & CHRISTIAN AFFILIATION

Volume 22 Number 5  October/November 1980

CARRYING ON

Ad astra per aspera! It seems a bit strange to see the name of Harry Lubansky instead of Bill Sisterson on communications from ASA headquarters. Otherwise things are about the same, including the lateness of this issue, as usual the fault of our Berkeley editor rather than our Elgin Elfin, Martha Wifdes.

The ASA is going well, but will go even better when we find a full-time executive director to manage our affairs and represent us to both the Christian and scientific communities. Suggestions or applications should be sent to either member of the search committee:

Kurt Weiss is current president of ASA; physicist 
Jack McIntyre of Texas A. & M. is a former ASA president. 

Current president of CSCA is Dan Osmond of the U. of Toronto medical Dept. of Physiology:

At its August meeting the ASA Executive Council instructed the Newsletter editor to list the name of the elected presidjent of both ASA and CSCA councils in each issue, and to encourage members to communicate directly with Affiliation officers on matters of concern. (While you're communicating, don't forget to send news items, large and small, to the Newsletter address on the back page-Ed.)

Before this reaches you the Canadian Scientific & Christian Affiliation will have held its 1980 Annual Meeting on Saturday, October 25, at Yorkminster Park Baptist Church in Toronto. Two addresses will be given by Dr. D. McCormack Smyth, professor of administration at Atkinson College of York University. Dr. Smyth is chair of the Board of Governors of Elliot Lake Centre and of the Canadian Institute for Radiation Safety. A dedicated Christian and member of Kingsway Baptist Church in Toronto, he is deeply concerned about blending scientific knowledge and Christian understanding in regard to safe use of nuclear energy for domestic, industrial, and even military purposes. His morning lecture is on "Intellectual Roots of Mankind's Current Crises" (or "How we got into the mess we're in"), his afternoon lecture on "Christian Responses to These Crises" (or "Why, how, and where we should respond").

In addition to opportunities to discuss Smyth's lectures and participate in a business meeting, CSCA members will see a premiere showing of the new tape/slide presentation on "Creation and Evolution." Busily revising the first version have been Jim Billington, Lance Nordstrom (now at Regent College), Elizabeth McKinlay, Mary Thompson, Paul Friesen, and others. Hilda Overweg, chair of the literature committee for the Toronto section, intends to return to Toronto from her studies at Trinity Christian College in Palos Heights, Illinois, to help operate the CSCA book table.

In another feature of this year's Annual Meeting, members of the CSCA Speakers Bureau will introduce themselves and their topics in 5-minute presentations, to help members and friends choose persons best suited to address their churches, schools, or other groups. Dan Osmond, who is retiring from the CSCA presidency but remaining on the council, will preside at the morning session, Ian Taylor at the afternoon session. Registration is being handled by Don Erling.

The news is that the keynote speaker for the 1981 ANNUAL MEETING will be Dr. Owen Gingerich, astrophysicist at the Smithsonian Astrophysical Observatory and professor of astronomy and the history of science at Harvard University. Professor Gingerich edited the collection of Scientific American articles entitled New Frontiers in Astronomy, has published many technical articles and reviews, and is a leading authority on Copernicus and Kepler. His talks on the past, present, and future of the universe given to the New York City Area section last spring were very well received.

The remarkable thing is that Alternatives Magazine (AM) takes note of science at all. Established in 1973 as simply a clearing house of information on Christian activities in the New York City area, AM has grown into a successful experiment in regional journalism and a witness to the wholeness of the Body of Christ. It is published by founder Joe Battaglia and edited by Phil Bagdon, both active in the sales and promotion end of Christian broadcasting. Beside the 0-irectorv of over 250 Christian endeavQrs_finzWd1nq o-ur local ASA section), ads, and profiles of area ministries found in earlier issues, AM now carries news and commentary on topics from the arts to world politics.

This past June the AM editor dropped in on our Newsletter office in Berkeley. Phil Bagdon is an impressive young guy with a B.S. in printing management from West Virginia Tech and a vision for using that background to witness effectively to his own ("Woodstock") generation. He understands our problem of trying to bridge the gap between the scientific and Christian communities partly because he stands in the gap between the power chord rock culture and mainstream evangelicalism.

Alternatives tries to meet the needs of Christians for many kinds of information and encouragement. Publisher Battaglia has linked the magazine up with the ministries of Dave and Darlene Swanson in an organization called Encouragement, Inc. One facet of the total ministry is sponsorship of contemporary Christian and classical concerts. Eventually AM hopes to aim more toward secular readers "as an intelligent and professional voice in response to the issues of the day-a voice which can speak to the non-Christian with clarity and conviction from a Biblical viewpoint."

Write to Jim Neidhardt at 146 Park Ave., RD No. 2, Randolph, NJ 07801; or to Phil Bagdon, AM Managing Editor, P.O. Box 785, Butler, NJ 07405. Alternatives is sold in Christian bookstores ($1 per issue) in the New York Metropolitan area, through bulk rates to churches or other organizations, and through individual subscriptions ($5 per year).

We mentioned last time that the Newsletter editor is supposed to make up a dummy issue of a popular ASA/CSCA publication on science and faith. Former executive secretary Harold Hartzler has long agitated for such a publication as the best way of getting our Affiliation message to people "in pulpit and pew" who most need it. Bill Sisterson's experiments in direct mail advertising convinced him that at least some people "out there" would subscribe. We would have to have enough subscribers to break even, of course. Journal ASA has about a thousand or two subscribers beyond our own membership.

Seeking an affordable format, we examined some of the popular science magazines already on the market. We don't mean just Popular Science, either, but the amazing variety of heavy-duty slicks such as Natural History, Psychology Today, Smithsonian, Audubon, the luxurious Geo, AAAS's Science 80, and the brand-new Time-Life entry, Discover, not to mention the classic National Geographic. A Time magazine story (15 Sept 1980) on competition between commercial and nonprofit magazines clued us on the circulation of such magazines: Science 80 hag an estimated 400,000 in its first year, Natural History has 478,000, Smithsonian 1.8 million, National Geographic 10.4 million. Obviously, science is popular!

Even if a "Christian Science 80" was what Harold Hartzler had in mind, we'll have to start out a lot more humbly than that. Right now we lean toward an 8-page format (not unlike ICR's Acts & Facts), laid out more artistically than our ASA/ CSCA Newsletter, with the hope that it might eventually grow into something looking like the weekly Science News published by Science Service, Inc., of Washington, DC. The publication would feature stories of Christians at work in science and technology, interpretive reporting of scientific news with religious implications, perhaps short essays or even sermon-ready homilies on science and faith, answers to readers' questions, and what else? Maybe some science games or puzzles for kids? Book reviews? Practical helps for stewardship of natural resources?

Brainstorming about the publication at the 1980 Annual Meeting, some of us tried to come up with an appropriate title. We preferred a single word to combinations like Science and Faith, but what word? Think came to mind but somebody thought it was already in use by IBM. (Lightled to a counter-proposal of Heavy or Semi-Heavy.) Catalyst is a local American Chemical Society publication. The Newsletter editor leans toward Balance or maybe Synthesis as the one word most clearly indicating what the publication is all about.

"Publication X" can use all the help it can get. Send your ideas for name, format, style, content, or funding to Wait Hearn, Dummy Editor, 762 Arlington Ave., Berkeley, CA 94707.

ORIGINS: RELIGION

In a "Forum" article in Faith Today (Sept/Oct 1980), a wide circulation magazine giving "a Canadian Christian perspective, CSCA president Daniel H. Osmond jumps into the "creationist/evolutionst controversy" with both feet. Responding to a comment in the magazine that "Creationist scientists who desire to debate clef enders of the evolutionary viewpoint are finding difficulty in locating an opponent," Dan, a biochemist, offers reasons for not joining in such debates even if one is convinced the "Creationists" are on the wrong track.

Arguing that a closed system of logic and doctrine will always "win" in a debate, just as the Jehovah's Witnesses continually seem to triumph over Christians, Dan says that creationist/evolutionist debates hopelessly confuse "the Philosophy of Atheistic Evolution (Big E Evolution) and the scientific theory of evolution (small e evolution) based on much reliable evidence." Debates based on rejection of valid evidence antagonize the unsaved and divide Christians. With such unproductive ends, "small wonder that Creationists attract few worthy debaters."

Dan Osmond closes his Faith Today comment with his address and an invitation to "write for a brochure pointing to a better way of dealing with the Evolution Controversy."

We used to think the courts were the worst possible place to take up the so-called "creation/evolution controversy," We hadn't imagined it could come upin apolitical campaign! But according to a story by Constance Holden inScience(12 Sept 1980), Republican presidential candidate Ronald Reagan was asked at a press conference following a speech to "a fundamentalist religious coalition in Dallas" if he thought the theory of evolution should be taught in public schools. Reagan responded, "Well, it is a theory, it is a scientific theory only, and it has in recent years been challenged in the world of science and is not yet believed in the scientific community to be as infallible as it once was believed. But if it was going to be taught in the schools, then I think that also the biblical theory of creation, which is not a theory but the biblical story of creation, should also be taught."

Democratic candidate Jimmy Carter, of course, was eventually asked his views on the subject. In another Science story (3 Oct 1980), Barbara Culliton reported the president's official statement: "The scientific evidence that the earth was formed about four and a half billion years ago and that life developed over this period of time is convincing. I believe that responsible science and religion work hand in hand to provide important answers concerning our existence on the earth. My own personal faith leads me to believe God is in control of the ongoing processes of creation. Insofar as the school curriculum is concerned, state and local school boards should exercise that responsibility in a manner consistent with the Constitutional mandate of separation of church and state."

One of those two statements should satisfy any voter but a diehard atheist-on that issue. Of course, Reagan and Carter aren't the only choices. On the ballot in California, at least, are also John Anderson (Independent) Barry Commoner (Citizens Party), Ed Clark (Libertarian Party), Maureen Smith (Peace and Freedom Party), and John Rarick (American Independent Party). We're not sure how they come down on the issue of evolution, but almost every one of them makes more sense to us on at least one issue than either of the two leading candidates. Further, they're wasting a lot less of the world's resources trying to get elected.

Lack of enthusiasm for this year's major party candidates stems from many causes, but surely one cause is the superficiality of the whole media-influenced campaign circus. Why should millions of dollars be spent on a show nobody wants to see? The Newsletter editor has come up with an alternative to escalating campaign madness. In "Politics for Peanuts" (Radix, Sept/Oct 1980), Walt Hearn advocates sequestering all the presidential candidates together on Alcatraz for the month preceding election day; every day the Coast Guard would take a major policy question out to them and bring back their replies from the day before to give to the media. Maximum focus on issues at minimal cost is the basic idea, says Walt, who is willing to modify details of his scheme. He chose Alcatraz Island in San Francisco Bay because its facilities were built for the purpose of isolating people, because the National Park Service already owns it-and probably because he was gazing out at it from his Berkeley window when the idea came to him. (Radix magazine's address is P.O. Box 2116, Berkeley, CA 94702; $10 per six issues or $1.50 per issue.)

Robert C. Newman, professor of New Testament at Biblical Theological Seminary in Hatfield, Pennsylvania, has been instrumental in founding a new organization called the Interdisciplinary Biblical Research Institute (IBRI). A number of other ASA members are also associated with IBRI, which began a year ago and now has about 40 members.

Is the Institute another school? No, according to the brochure Bob sent us it is "a group of like-minded Christians who see a desperate need for men and women believing in the complete trustworthiness of the Bible to get training both in Biblical studies and other academic disciplines and to use this training in helping Christians deal with the many areas where non-Christian teaching is so dominant today."

General objectives of IBRI are the strengthening of the church in evangelism and academic competence; defense of Christianity against intellectual attack; preparation and distribution of educational materials; support of research related to IBRI objectives; development of distinctively Christian approach to academic disciplines; and preparation of Christian scholars "who will strengthen the faculties of Christian institutions of higher education and provide a strong Christian presence in secular institutions."

IBRI also has several local objectives for its southeastern Pennsylvania area, beginning with development of doctoral programs in Biblical exegesis and apologetics at Biblical Theological Seminary. They also hope to help Pinebrook Junior College gain full accreditation and eventually become a four-year liberal arts college. After that they hope to put together a Christian graduate school to operate in a consortium with those schools.

How do they plan to do all this, and how did they get off to such a roaring start? Bob says the colloquium has already proved very stimulating, but of course funds are quite limited at present. The first catalogue of publications will comprise materials already written by IBRI people, who are also converting some of their slide talks on biblical subjects into cassette- narrated presentations. They hope to find funds not only for new publishing ventures (perhaps even videotapes) but also for scholarship aid for students seeking a solid Christian interdisciplinary education. Contributions would be gratefully accepted, Bob assures us.

The four-point doctrinal statement is much fuller than our ASA/CSCA statement, but from IBRI's viewpoint has been limited to the basics "because we think real Christians should be able to work together and emphasize their agreements rather than their differences." Anyone agreeing with the objectives and doctrinal statement can become a "Friend of IBRI." From that group the IBRI Board will select certain people as "Associates" if they have "an earned academic doctorate (Ph.D. or Th.D.) in some field or an M.Div. or equivalent from a seminary program emphasizing Biblical exegesis."

The third class of members, the "Fellows," must possess both of those degrees. It is anticipated that the Associates and Fellows will be doing most of the research, publishing, and speaking for IBRI, but not necessarily all of it. Beside Bob Newman as director, IBRI officers include secretary Gary Harlow, associate professor of engineering math at Drexel U., and treasurer Perry Phillips, instructor of physical science and Bible at Pinebrook Junior College. Present Fellows include Allan MacRae and Robert Vannoy of Biblical, James Boice of 10th Presbyterian Church, Frank Roberts of Delaware Valley Christian School, David Dunbar of Trinity Evangelical Divinity School, and Dale Pleticha of The King's College.

For information or membership applications (no dues for Friends; $5 per year for Associates and Fellows), write to Dr. Robert C. Newman, Director, Interdisciplinary Biblical Research Institute, P.O. Box 145, Hatfield, PA 19440.

(Can it be that this HOW TO series has been dormant since Feb/Mar 1979? Sure enough, No. 32 appeared in that issue. It described a dream Bob Newman and Herman Eckelmann had back at Cornell that is becoming a reality in IBRI. That should encourage you to send us the story of some innovation you're working on in the Lord's name, even if it's still mostly a dream. (We can always do a follow-up story when it succeeds-or when you learn something from its failure that might be useful to others-Ed.)

Chemist Charles B. Thaxton of Probe Ministries International in Dallas originally thought he had been invited to a relatively small creation/evolution seminar. Some 1,200 attended that seminar, many students asking thoughtful questions about origins. Charlie gave Probe curriculum materials to Korea's minister of education for consideration as supplementary reading in certain courses. He also presented a critique of chemical evolution to over a hundred scientists at KAIS (Korean Advanced Institute of Science) and spoke to two Korean churches.

Some ten million people participated in the week's activities and many were added to the church. Missionaries told Charlie that some Koreans simply add Jesus to the gods they already have, Shamanism being the most popular religious influence in the country. "it is not uncommon in Korea to see a car broken down on the side of a road with a Shamanist priest dancing around the car giving incantations to appease the evil spirit so the car will go again." Charlie tried to understand what was going on politically during his short visit. He concluded that the government is trying to keep everything in delicate balance to maintain "order," since "it is anticipated that any social upheaval in Seoul will encourage invasion from North Korea, only 25 miles away." But "the Korean Christians are full of prayer that God will preserve their nation to fulfill their dream. Their confident hope is that God will use them to evangelize mainland China."

Echoing Charlie's description of the commitment of "the fastest-growing church in the world" and their impressive enthusiasm is neurophysiologist Gary /. Allen, whose Campus Crusade ministry is to leaders from many countries at the United Nations in New York City. At one gigantic outdoor meeting in Seoul, Gary says, two million people came during a heavy rain that had begun hours before. Gary himself spoke to gatherings of thousands of students and professionals. He found God opening doors for future contacts at the U.N., often through quite unexpected chains of events. Returning with letters of introduction to U.N. diplomats from Korean leaders who are their personal friends, Gary looks forward to a more fruitful ministry as a result of his trip.

Later, in the Berkeley Independent-Gazette, we found out why. Reporter Steve Kanigher's story, "El Cerrito Biochemist's Smell of Success," tells how John's olfactory research is beginning to pay off. Several years ago this Newsletter described John's stereochernical theory, proposed in 1952, which has become the leading theory of odor. John showed that five primary odors (ethereal, camphoraceous, musky, floral, minty) could be distinguished on the basis of molecular shape and that two more (pungent, putrid) depend not on shape but on positive or negative charges on the vapor molecules. Now he thinks that as many as 30 or 40 primary odors may exist. Recently his semi-quantitative methods of assaying odoriferous substances have led to several significant applications.

John has put together a medical kit for testing a patient's sense of smell, using plastic squeeze bottles containing graded concentrations of (smelly) pyridine in (non-smelly) mineral oil. Each numbered bottle delivers a standardized puff to the patient's nose, enabling a physician to establish a threshold of sensitivity to the smell of pyridine. A subnormal olfactory sense can be due to mechanical blockage of an airway, overexposure to certain industrial chemicals, a head injury, head cold, allergy, vitamin deficiency, smoking, or alcoholism. Hypersensitivity may indicate epilepsy, schizophrenia, a pituitary tumor, or an effect of caffeine or strychnine ingestion.

John hopes to develop similar kits, with other compounds, to determine whether a patient is unable to detect particular primary odors. "Even if a cure can't be found for such a defect, which is probably genetic," he says, "the tests would help relatives and friends realize why a person can't smell a particular odor and would put an end to many arguments over household odors."

A higher priority is to develop kits to be used by employees exposed to industrial chemicals. Appropriate "sniff kits" could enable workers to test their environments for concentrations of dangerous chemicals above the permissible levels set by the Occupational Safety and Health Administration (OSHA). The kits could also single out individuals who can't smell certain chemicals or fumes at all, and who consequently shouldn't be working in such places.

PEOPLE LOOKING FOR POSITIONS

Gary Doolittle (Dept. of Biochemistry, Dartmouth Medical School, Hanover, NH 03755; tel. 603-646-2711) seeks a postdoctoral position in biochemistry for early 1981. A new member of ASA, Gary has a strong interest in molecular biology and expects to receive his Ph.D. in late 1980.

Charles Faupel (Division of Criminal Justice, University of Delaware, Newark, DE  seeks a teaching position in sociology for fall 1981. He has a B.A. in sociology from Asbury College and an M.A. in sociology from Central Michigan U., expects his Ph.D. from the U. of Delaware in summer 1981. Chuck is currently a research associate in the University's Division of Criminal Justice, studying the relationship between heroin use and crime on a project funded by NIDA. He has teaching interests in deviance and criminality, urban sociology, sociology of disaster, and introductory sociology; would like to develop a course integrating sociology and Christian principles; has published or presented a number of papers in his fields of interest.

Taylor University in Indiana has a vacancy in chemistry for 1981-82 and beyond, a tenure-track position for a person to teach physical and general chemistry and be responsible for the associated laboratories. Ability to participate in analytical lab or a team-taught advanced lab is also desirable. Appointee will be expected to initiate and direct financially feasible research projects in physical or biophysical chemistry by undergraduate students. Contact: Dr. Robert D. Pitts, Vice-president for Academic Affairs, Taylor University, Upland, IN 46989. (Received 6 Sept 1980, from Stanley L. Burden head of Taylor's Dept. of Chemistry.)

Westmont College in California is still looking for the right person for their chemistry faculty (see Aug/Sept Newsletter for description of position). Christian commitment to use teaching and research abilities overseas in rotation with present faculty is as important as excellence in teaching general plus some combination of analytical/organic/physical chemistry. Westmont president David Winter supports the concept of blending teaching with nonprofessional missionary assignments. Deadline for applications: 1 Jan 1980. Contact: Dr. Stanley E. Anderson, Chair, Dept. of Chemistry, Westmont College, 955 LaPaz Road, Santa Barbara, CA 93108. (Received 25 Sept 1980.)

LOCAL SECTION ACTIVITIES

WASHINGTON-BALTI MORE

Saturday, November 8, is set for an exciting symposium cosponsored with the C. S. Lewis Institute of Christian Studies on "The Church in the Genetic Age." The meeting will be held at National Presbyterian Church, 4101 Nebraska Ave. NW, Washington, DC, with the program beginning at 9:30 a.m. and adjournment at 4 p.m.

In the morning a report on the current status of genetic science and technology will be given by Dr. David A. Jackson, vice-president of Genex Laboratories of Rockville, MD; followed by a report on the current legal status of genetics research from Dr. Robert Acker, executive director of the American Society for Microbiology.

After those two presentations, "A Critique of Genetics Research" will be offered by Jeremy Rifkin, director of The People's Business Commission (1346 Connecticut Ave. NW, Washington, DC). Rifkin is author of The Emerging Order, a surprisingly complimentary treatment of American evangelicals by an outsider, as well as Who Should Play God?, a broadside against genetic research.

In the afternoon Douglas Badger, congressional liaison for Christian Action Council (14th & F Streets NW, Washington, DC), will present "Biblical Perspectives on Genetics Research" and all four speakers will participate in a panel discussion.

Thanks to PaulArveson for sending us this information. The border around the meeting program, by the way, is not only artistic but especially appropriate: the sequence of bases in the human insulin gene (AGCCCTCCAGGACAGGCTGCA ... ETC.).

The Toronto section seems to have a knack for getting things done. Beside the examples they've set for the rest of us by producing an effective tape/slide show and publishing a local Newsletter, they've begun to get people in the same field together for serious discussion. For example, chairman Gerry de Konig announced to the August 27 meeting of the section that four people are firmly interested in meeting regularly as "Christians in Computing" to think through the Christian implications of computers and their use. Also at that meeting, Bob VanderVennen reported on the 1980 ASA Annual Meeting in Indiana, which he had just attended. Our thanks to Bob for a copy of the minutes of that meeting and to Ken for the Toronto Newsletter.

OTTAWA

From both CSCA president Dan Osmond and Ken Kosow's Toronto Newsletter, we hear that the feelers sent out last spring by Richard Herd of the Geological Survey have paid off. On June 6, some 19-people attended a meeting and on June 21 the CSCA office received the form officially creating the new section, with the signatures of 13 charter members. This section in the nation's capital has a potential outreach to people at all levels of government. The Public Service Christian Fellowship has agreed to advertise the new CSCA section's activities in its newsletter, and there is a possibility that the section might host the 1981 CSCA Annual Meeting.

SAN FRANCISCO BAY

By carrier pelican flying up from theSouth Bay we've learned that a meeting is planned for Saturday, November 15, at Menlo Park Presbyterian Church. We can't tell you any more than that because evidently the pelican swallowed the rest of the message.

PERSONALS

anon. sent us a new address (Abbot Hill Acres, Wilton, NH 03086) and a wonderfully long report on winding up her work in Mexico. Elinor is scheduled to move to Africa, specifically to Cameroun, where Wycliffe has another field training course similar to the one in Mexico where she has taught for four years. After some six months in France to master French she will work in one-of the 200 tribal languages of Cameroun on a Bible translation project, serving on the Africa Orientation Course staff about three months of each year. Even before that, though, Elinor is returning to Brandeis University to complete her Ph.D. in anthropology, praising God that she has been reinstated after eight years at the same level at which she "dropped out." That means she can dive right into her dissertation research without having to repeat courses or comprehensive exams. She came back from Mexico with not just one but two possible dissertation topics, one that would require a return trip to the Tzeltal area, the other a "spare" in case such travel became impossible. (Good ' thinking, hermana. That reminds us of David's picking up three stones for his sling even though he klobbered the giant with his first shot.)

Richard H. Bube of Stanford University in California was one of five speakers at a 1980 Science, Philosophy, and Religion Symposium held in September at the Air Force Weapons Laboratory, Kirtland Air Force Base, New Mexico. Theme of the symposium was "A Personal Philosophy in the Changing National Defense and Energy Environment." Bill Moeny was Dick's host.

James 0. Buswell, ///, has told us a bit more about his new position at William Carey International University, Pasadena, California, of which Ralph Winter is founder and president. Jim is Dean of Graduate Studies in the new university, which offers specialized graduate degrees in foreign cultural studies, various aspects of cross-cultural communications, and international development. A special feature is a nontraditional off-campus research-learning program, individually tailored to each degree candidate in the U.S. or overseas. Jim would be glad to correspond with anyone interested in such a program. Write to him at WCIU, 1539 E. Howard St., Pasadena, CA 91104. Formerly professor of anthropology at Wheaton College in Illinois, Jim has been on the ASA Executive Council and was ASA president in 1978.

Howard Claassen, now of Ashland, Oregon, was featured in the September Wheaton College alumni magazine as a retiring faculty member. Alton Everest sent us a co6y of the article on Howard, currently a member of the ASA Executive Council. We hadn't known that it was Howard who formed the "Fourth World Committee" that led to the HNGR (Human Needs and Global Resources) program at Wheaton, of which Wayne Bragg is now in charge. But we knew at least a couple of things the Wheaton Alumni didn't-that xenon is spelled with an x instead of a z and that fluorine doesn't have an ou in it. (Howard was in a group at Argonne National Lab that in 1962 produced a fluoride of xenon, the first rare gas compound ever known.) A visitor from the Oregon Extension Campus reports that Howard has been busily digging the foundation for his solar house this fall.

Colin Funk received his B.S. in biochemistry last spring from Queen's University in Kingston, Ontario. He is now a Ph.D. student in the Division of Experimental Medicine at the Royal Victoria Hospital in Montreal, Quebec, associated with McGill University. Colin is studying the role of prostaglandins in release of catecholamines from the adrenal medulla. He would like to hear from any other Affiliation members working in the field of prostaglandins (address: Apt. 1510,3450 Drummond St., Montreal, P.O., Canada H7G 1 Y2).

H. Harold Hartzler, who winters in Glendale, Arizona, and -summers in Mankato, Minnesota, since retiring from Mankato State, is a Mennonite and a peacemaker at all levels. He sent us a copy of a recent letter to the editor published in the Mankato Free Press in which Harold tried to portray the enormity and insanity of the nuclear arms race and called for decreasing rather than increasing the U.S. military budget. Harold gave a paper on world peace at the 1980 ASA Annual Meeting and also led a Sunday evening discussion on the topic at that meeting. On a somewhat smaller scale, Harold, a member of the Creation Research Society as well as ASA, keeps pleading with both groups to deal peacefully with each other: "We need to work together in order to extend the kingdom of God on this earth."

Richard A. Hendry, chemistry professor at Westminster College in New Wilmington, Pennsylvania, missed the ASA Annual Meeting because he was on his way to Urbana, Illinois. Dick has a sabbatical this year which he plans to spend in the laboratory of professor Kenneth L. Rinehart at the U. of Illinois Department of Chemistry.

Sid Macaulay is regional director of the southeastern office of the Christian Medical Society, headquartered in Decatur, Georgia. Sid has been attending Annual Meetings of ASA, hoping to draw ASA and CIVIS closer together whenever possible, as in cosponsoring symposia or other events. In particular he would like to hear from ASA members attending scientific meetings in the southeast who might be able to speak at a CMS chapter "hungry for some responsible Christian thinking" (address: 124 Garden Lane, Decatur, GA 30030).

Margaret Munro will be leaving Toronto at the end of December to chair the undergraduate program in the Faculty of Nursing at the U. of Calgary in Alberta. Margaret graduated from the U. of Toronto and has taught in the Faculty of Nursing there since 1967 after some teaching experience in Petersborough, Ontario, and Saskatoon, Saskatchewan. She received her Ph.D. in education at the U. of Michigan in 1979, where she studied models of teaching and evaluation. Marg will be missed by Toronto CSCA section members, who fully expect her to start a new section in Calgary.-

David G. Myers, professor of psychology at Hope College, Holland, Michigan, has a new book out, published by Seabury Press. The Inflated Self., Human Illusions and the Biblical Call to Hope is described as "a sort of contemporary version of Ecclesiastes. It pokes fun at human nature. It pricks the inflated self. It calls us to a hope that does not depend on illusions. And in so doing it shows how recent research in social and cognitive psychology affirms biblical wisdom about human nature."

Pamela Naber has completed her B.A. at Calvin College in Michigan and is now doing graduate work in meteorology at the U. of Wisconsin in Madison.

Daniel H . Osmond of the U. of Toronto and current president of CSCA was interviewed in June on the Salvation Army radio program, "This Is My Story." Dan, a biochemist in a department of physiology, discussed the limitations of science and insisted that arrogant atheistic scientists show their own ignorance when they belittle people of faith. "The Bible is just as relevant today as it ever was, providing you do not treat itas if it were a scientific text." Nothing in science disproves the reliability of scripture, verified many times through historical and archaeological research. Conflicts arise when people "insist on their own misinterpretations of either scripture or science." The interview gave Dan an opportunity to plug CSCA and ASA, which bear witness of "highly competent scientists who are also Christian and yet have not sacrificed their professional integrity." Dan said the Affiliations "should provide the forum necessary to discuss rationally and humbly questions at the interface of science and religion."

William D. Sisterson's new address has been requested by a number of people since he left his executive position with ASA. We still don't have his home address but Bill can be reached at Pulpit Rock Church, 301 Austin Bluffs Parkway, Colorado Springs, CO 80907, where he is serving as business manager.

Don Wardell of Winona Lake, Indiana, offered "A Unique Exposition of Genesis 1:1-10" at the 1980 Annual Meeting that turned out to be a form of "progressive creationism." Don prefers the term "sequential creation," putting some distance between himself and young-earth creationists on one hand and theistic evolutionists on the other. (Copies of his little booklet, God Created [1978], on which he was hoping to get some scientific or theological feedback, are available for 300 plus 200 postage from Don at Box 325, Winona Lake, IN 46590.)

Warren Willis, serving Campus Crusade for Christ from a base in Guam, coined the term "Stop-out for Christ" last year as a play on "drop-out." So many college students took him up on it that their ministry overflowed the island of Guam. When we heard from Warren in May, he was expecting some 135 "stop-outs" to work with him for two months in the Philippines this summer. Then they were to take in an International Student Conference on World Evangelization in Seoul, Korea, 12-15 August, which may be why Charlie Thaxton of Probe was also headed thataway. (To invest in the ministry in Guam and Micronesia, with 75 new "stop-outs" due to arrive in September, contact Warren at P.O. Box E, Agana, Guam 93910. The Willises' account at CCC headquarters in Arrowhead Springs, CA, is #0057282.)